JUSTIN BIEBER - Never Say Never [Letra, Traduccion y Video] SOUNDTRACK KARATE KID



JUSTIN BIEBER Ft. JADEN SMITH - Never Say Never

See I never thought that I could walk through fire.
I never thought that I could take the burn.
I never had the strength to take it higher,
Until I reached the point of no return.

And there’s just no turning back,
When your hearts under attack,
Gonna give everything I have,
It’s my destiny.

I will never say never! (I will fight)
I will fight till forever! (make it right)
Whenever you knock me down,
I will not stay on the ground.
Pick it up,
Pick it up,
Pick it up,
Pick it up up up,
Adictivoz.com
And never say never.

I never thought I could feel this power.
I never thought that I could feel this free.
I’m strong enough to climb the highest tower.
And I’m fast enough to run across the sea.

And there’s just no turning back,
When your hearts under attack,
Gonna give everything I have,
Cause this is my destiny.

I will never say never! (I will fight)
I will fight till forever! (make it right)
Whenever you knock me down,
I will not stay on the ground.
Pick it up,
Pick it up,
Pick it up,
Adictivoz.com
Pick it up, up, up,
And never say never.

Here we go!
Guess who?
JSmith and Jb!
I gotcha lil bro.
I can handle him.
Hold up, aight?
I can handle him.

Now he’s bigger than me,
Taller than me.
And he’s older than me,
And stronger than me.
And his arms a little bit longer than me.
But he ain’t on a JB song with me!

I be trying a chill
They be trying to side with the thrill.
No pun intended, was raised by the power of Will.
Like Luke with the force, when push comes to shove.
Like Cobe with the 4th, ice water with blood.

I gotta be the best, and yes
We’re the flyest.
Like David and Goliath,
I conquered the giant.
So now I got the world in my hand,
I was born from two stars
So the moon’s where I land.

I will never say never! (I will fight)
I will fight till forever! (make it right)
Whenever you knock me down,
I will not stay on the ground.
Pick it up,
Pick it up,
Pick it up,
Pick it up, up, up,
And never say never.

I will never say never! (I will fight)
I will fight till forever! (make it right)
Whenever you knock me down,
I will not stay on the ground.
Pick it up,
Pick it up,
Pick it up,
Pick it up, up, up,
And never say never.

I will never say never! (I will fight)
I will fight till forever! (make it right)
Whenever you knock me down,
I will not stay on the ground.
Pick it up,
Pick it up,
Pick it up,
Pick it up, up, up,
And never say never.

NUNCA DIGAS NUNCA
[Traducida al Español]


Mira, yo nunca pensé que podría caminar sobre fuego
Nunca pensé que podría quemarme
Nunca tuve la fuerza para llevarlo mas alto,
Hasta que llegué al punto de no regresar

Y simplemente ya no hay vuelta atrás,
Cuando tu corazón te da un golpe bajo
Voy a darte todo lo que tengo,
Este es mi destino.

¡Yo nunca diré nunca! (Voy a luchar)
Voy a luchar por siempre! (Hacerlo bien)
Cada vez que me derribes,
No me quedaré en el suelo.
Me levantaré,
Levantaré,
Levantaré,
Levantaré-ré
Y nunca digas nunca.

Nunca pensé que podría sentir este poder.
Nunca pensé que podría sentirme libre.
Soy lo suficientemente fuerte para subir a la torre más alta.
Y soy lo suficientemente rápido para correr y cruzar el mar.

Y simplemente no hay vuelta atrás,
Cuando tu corazón te da un golpe bajo
Va a darte todo lo que tengo,
Porque este es mi destino.

¡Yo nunca diré nunca! (Voy a luchar)
Voy a luchar por siempre! (Hacerlo bien)
Cada vez que me derribes,
No me quedaré en el suelo.
Me levantaré,
Levantaré,
Levantaré,
Levantaré-ré
Adictivoz.com
Y nunca digas nunca.

¡Aquí vamos!
¿Adivina quién?
JSmith y JB!
Adictivoz.com
Te tengo lil bro.
Puedo manejarlo
Espera, Hey?
Puedo manejarlo.

Ahora él es más grande que yo,
Más alto que yo.
Y es mayor que yo,
Y más fuerte que yo.
Y sus brazos son un poco más grandes que yo.
Pero él no está con JB canta conmigo!

Yo intentando un escalofrío
Ellos tratan de ponerse al lado de la emoción.
No es un juego de palabras, fue criado por el poder de la Voluntad.

Al igual que Lucas, con la fuerza, cuando empuje vendré empujar.
Al igual que Cobe con el 4 de Julio, con la sangre.

Tengo que ser el mejor, y sí
Vamos a volar más alto
Al igual que David y Goliat,
I conquistar al gigante.
Así que ahora tengo el mundo en mi mano,
Nací de dos estrellas
Así que la luna esta sobre la tierra.

¡Yo nunca diré nunca! (Voy a luchar)
Voy a luchar por siempre! (Hacerlo bien)
Cada vez que me derribes,
No me quedaré en el suelo.
Me levantaré,
Levantaré,
Levantaré,
Levantaré-ré
Y nunca digas nunca. (x2).
COMENTAR CON TU PERFIL DE FACEBOOK
COMENTAR CON EL FORMULARIO DEL BLOG

223 comentarios :

  1. ámo a justin bieber espero ke algun dia benga a mexico

    ResponderEliminar
  2. me parece demaciado buena esta cancion
    justin ojala pueda venir a colombia

    ResponderEliminar
  3. las canciones de justin bieber son muy buenas jamas habia conocido a alguien con una voz tan hermosa y ademas el ritmo de sus canciones son muy originales y geniales!!!!

    I LOVE JUSTIN BIEBER!!!
    PLEACE COME TO CHILE!!!!!!!!!!!

    ResponderEliminar
  4. esta mui buena la cancion
    suerte en su talento de justin bieber
    ojala que venga a peru pz!! aver si se anima

    We will welcome you if you decide to come to peru

    ResponderEliminar
  5. que vonito juston me encanta sigue p`ssssssssssssssssssssssssssssssssssssssssssssssssss tu tambien jaden smith

    ResponderEliminar
  6. adoro la canciionnn!!! (L)

    ResponderEliminar
  7. jajajaja .... al parecer a j.b. le esta cambiando la voz ....q bn q bonix esta su cancion ....el esta re lindo esta mas grande....me gustan todas sus canciones....hehehe...espero q justin bieber venga a Guatemala q se recuerde q aqui tambn tiene fans y q lo queremos ... justin bieber veeeen por fiiis....=)..!!

    ResponderEliminar
  8. justin es bkn el todo es tan real no es falso sigui igual ke siempre no cambia su adolencia sigue haci te amamos haci cm eres

    ResponderEliminar
  9. me encanta justin pero me facino como rapio jaden smith
    la cancion esta realmente buena....
    :)

    ResponderEliminar
  10. AMOH a justin biebeeR suu musicaa es geniaaL Y me encntaa su voz aunqee cambiee
    tdas suus cancioonees soon ReeaLmntee geniaLees y estaa estade masiadooo bnaahh =) me a mucho gusto qe sigaa y su voz ezta ermosaa

    ResponderEliminar
  11. justin beiber esta bien pero lo malo es k, se paso de la raya e escuchado k se esta com parando con bandas recontra conocidas como TOKIO HOTEL , JONAS BROTHER, bueno son buenas tambien pero no creo k sea tanto, pero si sale sobre green day o linkin park va a perder
    PD: BUENA VOS AUNKE E ESCUCHADO K PARECE DE MUJER D

    ResponderEliminar
  12. me encantas justin beber tus canciones,tu voz,todo todo...eres genial espero que sigas asi :) y te des una pasadita a PerÚ ;)

    ResponderEliminar
  13. uuuufffff justtinn no no noo es hermosooooo y lo aamo perroo yoo diggo q jordan smith sera mejor q justin por q nos dejo sorprendidoss pero bnoo justin nuca dejara de ser cuapo yy bnoo ssu musica me encanta haahha bno besoss byebye

    ResponderEliminar
  14. Wooo lOS Dos Hacen un duo dinamico... me encantan y justin osea super Beiio i love My baby

    ResponderEliminar
  15. me encanta justin bieber es mi novio hehe amm y la cancion tbm a y tbm jaden smith 0ok byebye

    ResponderEliminar
  16. am0o0o0o0o0o0o0o a justin bieber hehe y me encanta la cancion a y tbm jaden smith

    ResponderEliminar
  17. w0ola I LOVE YOU JUSTIN BIEBER me necantan todas sus cancionex mi preferida es la d eenie meenie pr0o esta tbm esta genial como todo lo de el haha byebye y ojala q algun dia justin bieber vanga a mexico bye

    ResponderEliminar
  18. I LOVE JUSTIN BIBER ESTA ES MI CANCIO PREFERIDE APARTE DE LA DE BABY TE AMO SE Q ALGUN DIA TE CONOCERE POR Q SIEMPRE LO HE SOÑADO TE AMO Y NO DEJARE DE AMARTE T KIERO BYE KISSES KISSES MUA MUA MUA MUA MUA MUA MUA MUA MUA MUA MUA MUA Y MUA KISSES BYE

    ResponderEliminar
  19. te amo justin es mio no se los presto es mio mio mio mio mio mio mio mio mio mio mio mio 4 ever

    ResponderEliminar
  20. hey justin ere sel mejor te amo

    ResponderEliminar
  21. justin bieber se pudre de guapo y cody simpson se queda abajo quiero que vengas a ecuador y que sepas que aqa tambien tienes fans y yo soy una de esas

    ResponderEliminar
  22. Amo aa justin Bieber es el mejor sus musiks son buenisimas ... adore la nueva cn jaden ta cool spro q gane =)

    ResponderEliminar
  23. me parece una completa falta de tiempo escuchar a alguien tan pero tan carente de algun tipo de pensamiento...no tiene ni voz linda ademas de mujer es esa vos... tiene una apariensia denigrante... con un look espantosamente poco varonil...rodeado de una situacion de auntentico retardadooo... como les puede gustar un chiquito que tiene vos de mujer...
    y sin sentido las canciones
    aprendan un poco de musica

    ResponderEliminar
  24. callate vos anonimo justin es re lindo y no canta como mujer y el peinado es lo mas lindo de el no perdemos el tiempo escuchando porque nos encanta a las mujeres vos decis eso porque estas celoso de que las mujeres gusten de le y no de vos seguro que sos re feo y gordo

    ResponderEliminar
  25. Q hermoso que es algun dia que venga a la argentina ♥ segui assi justin YEGARAS MUY ALTO♥

    ResponderEliminar
  26. justin muy talentoso siga asiii !!....jaden smith si va hacer como su padre llegara lejos muy buen actor ..la cancion demaciadamente brutal!!!justin ojala un dia visites Puerto Rico

    ResponderEliminar
  27. jum muy solprendida los dos me encantan pero jade smith me facina es vdd que si sigue asi va muy bien y la pelicula ni se diggaaa super brutal..!!!pero espero que algun dia los dos visiten a puerto rico!!!

    ResponderEliminar
  28. huy dios mio sra que justin no es gay es demasiado lindo mua, ademas canta divino y sabes me gustan mucho tus pintas

    ResponderEliminar
  29. bien!! me encanta la cancion! es mi preferida! canta de puta madre! y k sepais a los k no lo saben....YA LE HA CAMBIADO LA VOZ!! ES ESTA! COMPARAR ESTA CON LA DE BABY!
    jaden para mi canta bien, pero nada comparado con justin!
    justin a ganado a los jonas!! toma toma toma! si esk justin no le supera nadie!! muahaha
    a y una cosa, kien le insulte, antes k se mire al espejo vale retrasaos?!¬¬'

    ResponderEliminar
  30. amo a justin bieber su musica es lo mejor del mundo dice cosas lindas y emocionantes!!!!
    =D
    canta bn baila bn es lo mejor del mundo

    ResponderEliminar
  31. en español:el significado de esta cancion es q nunca te des por vencido y sigue adelante.nunca digas nunca


    In English:The meaning of this song is never q you des for conquered and continues adelante.never say never

    ResponderEliminar
  32. i am from Argentina and I love all the songs justin, is Hermes also sings and dances really good and hopefully I will leave some day come ah Argentina

    ResponderEliminar
  33. aii justinn VENITE A ARGENTINA♥ me encanta la cancion!!
    aiaiai pero jaden smith no se qeda atrass lo adoroo a jadenn!!♥♥ i justin buenoo qe decir de voos! ya lo dijieron toodoo!=D

    ResponderEliminar
  34. en realidad no me gusta demaciado la musica de justin bieber,, pero en realidad me gustaria qee vieniera a colombia con j smith i qe canten esta cancion en su concierto

    ResponderEliminar
  35. ufff ese niño esta relindo
    ********* justin bieber ven a colombia porfabor*******
    mucha estupida la que no crea o la que no acepte que justin es super talentoso y relindo
    :) ven a colombia te estare esperando junto con todo mi pais

    ResponderEliminar
  36. chicas,,"JUSTIN" NO VA A LEER ESTO.
    NO ENTIENDO POR QUE ESCRIBEN COMO SI EL FUERA A LEER ALGO.
    EL ESTA EN LA SUYA.Y ME PARECE BN--

    ES MUY TALENTOSO ESE CHICO..TIENE EL DON!

    ResponderEliminar
  37. es super linda esta cancion y si quieren hablar con el creen su twitter pero es algo imposible q les conteste q cole gggggggg

    ResponderEliminar
  38. tengo el msm de justin bieber !!!!ahhhhhhhhhhhh y puso cam es bn lindo

    ResponderEliminar
  39. I love justin bieber !! please dame ese msn soy inglesa pero se hablar un poco de español porque mi prima es de ahii please and i te doy el de selena gomez si te interesa okk
    !! (L)

    ResponderEliminar
  40. me encanta como canta y lo que dicen sus canciones =)

    ResponderEliminar
  41. justin bieber eres lo mejor eres mi idolo por sorpresa
    te amooooooooooooooooooooooooooooooooooooooooooooooooooooooo te kierooooooooooooooooooooooooooooooooooooooooooooo y te adorooooooooooooooooooooooooooooooooooooooooooooo

    responde aeste comentario mi messenger es
    estrellita_citlalli@otmail.com
    asi como esta escrito

    ResponderEliminar
  42. De FMR:
    Esta buena la canción, debe de ser la unica canción de justin bieber que me atrae, ya que en el resto de sus canciones no he notado argumento ninguno.
    Y que no se esfuerze ninguna de las chicas o chicos que lo admiran, en insultarme o tratar de ofenderme de alguna forma por mi comentario, ya que no creo que vuelva a entrar otra vez a esta página en mi vida (Ya que ya obtuve la información que necesitaba de la misma).
    Por otra parte, en el momento que veía la película, al escuchar la canción, pense que la cantaba una mujer y nadie puede decir que su voz no tiene un ligero toque de afemeneidad el cual se nota cuando canta.
    Para terminar hablare de JS (jaden smith), lo primero que debo destacar es que ha diferencia de justin, la primera vez que lo escuche cantar (que seria esta) me gusto y mucho, lo segundo que dastaco y lo ultimo es la fluidez y lo bien que sabe bailar y actuar, tal como lo hace en su pelicula.

    ResponderEliminar
  43. joooodeer .. loo siientoo por laas palabrootas .. :/ ..
    soii de la paterna .. de las palmas de gran canarias ..
    yo quisiera que justin bieber viniera a la isla de gran canarias dar un concierto =( ..
    para que el si vea las fans que tiene aqui se ba a kedar sorprendido ='(..
    no se por que cuando veo a justin en algun video clips me pongo nerviosa , tal vez por que aparteee deee que es guapisimooo (baba)
    kee es el en el uniico kee mee eh fijado en las muecas ke ase :/ ..
    cuando canta me eh fijado en su corazon (heart)
    I LOVE JUSTIN BIEBER (L)

    ResponderEliminar
  44. me encanta esta cancion justin te aaaaaaaaamoooooo ven a peru pliiiiiisss

    ResponderEliminar
  45. o0ig@n yo0 digo0 k justin es lo0 mejo0r lo0 ado0ro0 es lo0 maximo0 y es wapisimo0 o0 saludo0s pasatela chido0 o0k bye

    ResponderEliminar
  46. Hi Justin're great, I'm your fan number one, you're handsome and I love your personality
    you should come to Spain for a concert, and do not let others take away the post you have only envy. I love you I´m Lety.
    Kiss
    ♥(L)♥#1

    ResponderEliminar
  47. justin me encanta tu musica y me encantarias que vengas al ecuador y me encanta esta cancion te deseo mucha suerte en tu carrera te amo muchoooooooooooo chao

    ResponderEliminar
  48. oOla
    waaa no manshess
    k hermosaa
    kanciion
    d me noveo

    sii me ennkantha
    komo kantha ii
    no manshess
    lo k diicenn suss
    letrass waaa
    me iiego =´D

    amm
    well
    bye

    ResponderEliminar
  49. waaaaaapoo-i love you m nkantan todas tus canciones

    ResponderEliminar
  50. Osea Justin Biber no es lindo feo... es normal... me gustan alguna de sus canciones.. pero ta tampoco es q me muera x el..
    Jadem Smith es un amor ese niñoo!! jaja va a llegar muy lejos
    Demas la cancion never say never ;)

    ResponderEliminar
  51. si la verdad es que justin es muuy bonito.. bah es un bombon pero jaden en verdad tiene lo suyo... son bonitos los dos, aunque Jaden es menos lindo que Justin.
    En verdad concuerdo un poco con el o esa (creo que es el porque re insulto a Justin) de que la voz no es muuuy de macho(de hombre maduro) pero bueno cada uno tiene su voz y cada uno tiene sus gustos). Ademas es un nene,tiene 16 años, bueno yo tengo 14 pero digo de que no es como Zac Efron que tiene 22 entienden, es mas chico , por lo tanto la voz no es de hombre adulto. Y es verdad la voz de justin cambio de Baby a Never Say Never.
    La cancion Never Say Never te da una muy buena leccion. Te hace pensar y darte cuenta de muchas cosas. Jaden Smith se pasa me encanta como baila!!! ¿Cuantos años tiene Jaden? Parece de 9 o 10 . En la pelicula Karate Kid hace de 12 pero me da sensacion de que es mas chico.
    Bueno yo espero que Justin venga a Uruguay. Nadie lo debe conocer, pero es un pais que esta al lado de Argentina y abajo de Brasil.Es muy chiquito el pais pero somos grandes de corazon jaja
    Un beso para todos y todas los/as que comentaron . Porrque aunque algunos hayan insultado a JB y JS me caen bien porque dicen lo que piensan
    Chauusiito Aby

    ResponderEliminar
  52. AMO A ESTA CANCION !!!!!!!!!!!!!!!!!!!!!!!!!!!!!1

    ResponderEliminar
  53. I love you justin bieber and jaden Smith!♥♥
    ojala que vengan a Culiacan,Sinaloa
    me encanto la pelicula de karate kid
    tambien me encanto la cancion


    bay

    ResponderEliminar
  54. k buena cancipn me encantas justi I LOVE JUSTIN

    ResponderEliminar
  55. esta cancion es sper me encata justin bieber y me gustaria q algun dia venga a Peru

    ResponderEliminar
  56. te amo justin sigue asi nunka termines de enamorarnos con tu voz (i love you justin drew bieber malette) my beautiful boy tee amo con todo mi corazon te tengo en mi vida (life)

    ResponderEliminar
  57. hola t amo justin quiero ser t fans numro#1 t amo te quiero haaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
    t amo quiero sigue asi I love sigue asi
    te amo qeria q yo sea tu novia pero ya tienes

    si contesta contesta a mi

    ResponderEliminar
  58. la cancion de never say never es muy bonita me guta sigue asi justin XD

    ResponderEliminar
  59. k pasada de cancion !!!!!!!
    mola pilaaa!!!!!!!!!!

    ResponderEliminar
  60. justin es el mejor que ggaaa

    ResponderEliminar
  61. justin eres el mejor te qm espero que vengas a mexico

    ResponderEliminar
  62. espero que justin vanga a ecuador

    ResponderEliminar
  63. justin es guapisimo papacito

    ResponderEliminar
  64. justin bieber (JB) I LOVE YOU AND I LOVET YOU MIUSIC
    PLEASE VENI A LA ARGENTINA!!!!!!!!!!!!!!!!!!!!!
    TE AMOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡

    ResponderEliminar
  65. hay no ksi me muero cuando te veo justin eres el mas guapo pero guapo del mundo, te amo espero que no tengas novia, por q aqi esta tu bombon. me enkntan ts videos, canciones y demas. todo tu eres un cuero bien hecho. ojala hables aunq sea un poco de español y leas esto porq para mi es muy importante.ojala vengas a mexico gdl. te amooooooooo ILOVE JUSTIN BIEBER ILOVE YOU

    ResponderEliminar
  66. mvy vacan esta cancion ajola q jostin pveda venir aqvi a PERV pes<<<<........

    ResponderEliminar
  67. amo a jaden smiith es lo mjor justin kmo k iia paso de moda iia stha biejitho ande no amo a JADEN SMITH

    ResponderEliminar
  68. esta superguay justin sus canciones son geniales es el mejor insuperable siiiiiiiiiiiiiiiiiiiiii viva justin.

    ResponderEliminar
  69. mirella_love_@hotmail.commartes, 03 agosto, 2010

    justin bieber ojala que vengan a peru te
    amo eres muy lindo

    ResponderEliminar
  70. Justin Bieber vendra a Perú pero lo hara cuando ya no tenga fama cuando ya casi nadie lo recuerde ...el visitará Sudamerica cuando ya no tenga fama pero quien lo adora como yo nunca lo olvidara y guardara sus canciones en un lugar especial en su mente...XD
    I LOVE JUSTIN
    Jaden eres el mejor...besitos

    ResponderEliminar
  71. Mee encanta JUSTIN BIEBER, me fascinan sus canciones y sobre todo esta.."NUNCA DIGAS NUNCA"..
    Una amiga miia se muere por el, me encantaria que venga a TENERIFE y le compro una entrada, me querria para toda la vida jajajajaajjajja...¡¡¡¡

    ResponderEliminar
  72. ooooooooooooooooooohhhh... mijito ricooo, te kero mucho justin bieber, te amo, te adoro, me encantan todas tus canciones, pero por sobre todo never say never, ery los mas lindo en todo el planeta, teni una voz filete, y ke se pudran todos los ke te critican por tu voz, por tu frma de ser, a los gais nadie los molesta por ser como son, ¿por ke a ti si? ¿si al final tu no eres gay? too lo contrario eri el mas hombre de too, eri lo mas lindo en todo el planeta,eri lo mas lindo ede la fas de la tierra, no entiendo porke te critican tantoo, si no te conocen lo demasiado, como para hablar tantas estupideses de ti.

    ILOVE JUSTIN BIEBER...
    TE ESPERO AKI EN CHILEE!!
    CONFIA EN MII JUSTIN, KE YO TE APOYO, YO TE DEFIENDO, POR KE TE AMOO, Y TE ADOROO!!

    ATTE:

    ESPEO KE TODOS LOS IMBESILES KE CRITICAN A JUSTIN BIEBER POR SU VOZ, SU FORMA DE SER, O ALGUNA OTRA COSA, RECAPASITEN CON ESTE MENSAJE.

    ResponderEliminar
  73. HOLA JUSTIN ESTOY ESPERANDO QUE VENGAS A EL SALVADOR. TE ENCANTARA MUXO AUNQUE TU NO HABLAS ESPAÑOL PERO PODRAS A APRENDER POQUE TE QYUIERO CONOCER EN PERSONA. CUANDO VEGAS ME MORIRE DE EMOCION Y SIGUE ASI QUETODAS LAS CANCIONES TUYAS ME GUSTAS ESPECIALMENTE !NUNCA DIGAS NUNCA!!!!!!!!!!!!. TE ADORO JUSTIN TE ESTOY ESPERANDO ATT. F. E. Z. Q.................

    ResponderEliminar
  74. hola justin bieber me llamo renata me gusta esta cancion cuando vas a venir a peru

    ResponderEliminar
  75. ola justin me llamo catalina soy fans numero 1 de ti eres lo mejor de todos cuando vas a venir a chile te esperamos ojalas que vengas chao cuiidate besitos

    ResponderEliminar
  76. justin bieber te amo muxo eres lo mejor del pop ii cantas con mushio sentimiento te amo te amo te amo eres solo miomiomiomiomiomio te kiero kaleta

    ResponderEliminar
  77. Diana esquer Melissa acuña : )domingo, 08 agosto, 2010

    I LOVE SO MUCH JUSTIN BIEBER (L)
    ojala que puedas venir aser un consierto en hermosillo sonora mexico .

    ResponderEliminar
  78. justin bieber te quiero mucho como quisiera q agas un concierto en peru y la mejor cancion q me gusta es babi te quiero mucho

    ResponderEliminar
  79. jajaja!!! apuesto que todos los que dejan estos mensajes solo son torpes chicas ilucionadas con el y uno que otro gay jajajaja!!!! adema ustedes no saben que el nisiquieras sabe k existen entiendanlo de una ves firma:alguien.

    ResponderEliminar
  80. never say neverr...klaro staaa...i love you justinn !!!

    ResponderEliminar
  81. amo a just para mi el es perfecto y nadie me pued acer cambiar de opinion q copa2 el tema never say never nunca cambies justinnnnnnnn

    ResponderEliminar
  82. justin te amoooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo Y LOVE JUSTIN TE AMAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA SONIA.

    ResponderEliminar
  83. HOLA JUSTIN YO SOY SONIA YO TENGO 11. YO QUISIERA SER TU NOVIA Y NUNCA DEGARTE DE DARTE BESOS EN LA VIDA Y LOVE JUSTIN TE AMO CON TADO MI CORAZO.BESOS JUSTIN.TUS CANSIONES SON GRANDIOSAS LA DE 'BABY' ES GRANDIOSA YO LA TENGO EN LA CONPU Y YO SIEMPRE LA ESCUCHO. JUSTIN ERES SUPER CEXI Y MUY ARDIENTE TE AMOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO JUSTIN SONIA..

    ResponderEliminar
  84. hola justin soy juan de costa rica y tengo 19 y me encanta tu musica mas la de never say never

    ResponderEliminar
  85. hola q tal , soy peruana y tengo 13 , me gustaria q JUSTIN BIEBER venga a peru . buena cancion q hicieron , buen duo con JADEN SMITH . tienen mucho futuro , ojala se animen .no lo olviden porfa ok , chauuu

    ResponderEliminar
  86. justin bieber me gustan tus canciones espero q vengas al peru especialmente a trujillo para deleitar tus hermosas canciones q x sierto ia me las se bueno un poco

    ResponderEliminar
  87. me encanto bastante la letra de la cancion,....tiene un significado muy bello y creo q sus vidas estan reflejadas en esta cancion ....
    jb jamas se imagino tener la fama que tiene y llegar a donde llego y mirenlo aqui esta ...porque ...el nunca dijo nunca y espero que sea un ejemplo para cada una de las personas

    ResponderEliminar
  88. mee encantaa estaa canción es muu bonitaa!!! y sobre todo me encanta justin bieber y jaden smith ojalaa k vengan a andaluciaa!!

    ResponderEliminar
  89. me encanta sta cancion es 1 se mis favoritas justin es l mejor artista k scuchado seria muy bonito k pueda venir s bolivia lo adoro muchos besos y suerte en tu carrera t amo!!!!!!

    ResponderEliminar
  90. hola justin t amo eres realment hermoso sabes nunka m cansare de oir tus canciones tengo miles de fotos de ti en mi cel y n special tus canciones no dejar de oir tys canciones t adoro IIII LOVE YOU!!!!!!!! ATTE Angi

    ResponderEliminar
  91. BUENO VOY ADMITIR QUE EL JUSTIN ESTE CANTA MAS O MENOS PERO REALMENTE EL QUE SE LLEVA LA CORONA ES JADEN SMITH LE PONE UN TOQUE ESPECIAL A ESTA CANCION SIN JADEN ESTA CANSION NO SERIA LO MISMO!AARRIIIBAAAAAAAA!!!!!!!!!!!!! JJJAAAAADDDDDEEEEEEENNNNNNN SSSSSSSSMMMIIIIITTTHHH! JS JS LLEGARAS MUY ALTO! IGUAL QUE WILL!

    ResponderEliminar
  92. I LOVE J & JB !!!!!!!!

    ResponderEliminar
  93. creo que todas estamos de acuerdo en que justin bieber es un papacito y que cualquier chica estaria encantada de ser su novia
    I LOVE YOU MY BABY JUSTIN BIEBER!!!!!!!!!!!!!!!!!!!!!1

    ResponderEliminar
  94. ammmmmo a justin....justin veni porfavor aca en paraguay...yo si o si voy a tu concierto...si era por mi le mataria al q t tiro la botella...aca en PY t amamos somos muy solidarios aca...nosotros aca ayudamos y porfavor veni...y vas a ver q si es q venis aca t vamos a tratar como sifueras parte del PY...t amamos!!!

    ResponderEliminar
  95. hola soi galilea me encanta el vide o de never sai neber

    ResponderEliminar
  96. i love u 4ever JUSTIN..... <3!!!!!
    diox jaja (princesaleidy@hotmail.com)

    ResponderEliminar
  97. amOoOoo A JUSTINN ES Lo MAS y cOn esta sOn en seriO descriibe lO q en estOs momentos estOy pasandO estOy en ua etapa en la q tube q tOmar una duficil deciciOn y sOlO esO tengO q ser fuerte y nO dejarme derribar pOr q estar lejOs de tu familia y amiigOs nO es cosa faciil

    ResponderEliminar
  98. me encanta jaden smith (L)

    ResponderEliminar
  99. Justin Bieber es guapisimo pasate por españa o Por cantabriaaaa

    ResponderEliminar
  100. yo soy la fan numero 1, tengo el acolchado posters cortina utiles todoas sus canciones y me las se y cunado venga a la tinoamerica no me importa q sea peru, bolibia, chile, brasil etc yo voy a biajar y lo voy a ver pero es mejor q vengaa la argentina en fin justin bieber te amooooooooooooooo coon toda mi alma pienso en vos todos los dias y aveces sueño con el!! una vez soñes q estaba en mi escuela y me dio un artografo y despues me case con el en fin q raro :)!! no?? pero los sueños son asi´! a y me olide de contar q el q traia los anillos era un mono jajaja besos a las chicas q les gusta

    ResponderEliminar
  101. Amo a Jaden Smith! ♥

    ResponderEliminar
  102. me gusta justin bieber sus canciones son bonitas??????????????????????????????????????jajajajajajaja............

    ResponderEliminar
  103. hola yustin bieber te amo soy tu fan yespero que vengasa al peru muy prontote quieroooooooooo....

    ResponderEliminar
  104. i
    l
    o
    v
    e
    Justin te amo espero que algun
    dia vengas y me conoscas

    ResponderEliminar
  105. hola justin drew bieber ya se q no te gusta el cholate ni el helado te encanta la musica de ne-yo, eres lindo me encanta tus canciones me gustaria visitarte en canada me guasta como toas la guitarra,el piano,bateria,y la trompeta.

    ResponderEliminar
  106. justinn ni mexico ni peru ni chile ni mierdas d estas ventee a españa coñoo q es lo mejorr y siempre t esperaremosss!!

    ResponderEliminar
  107. andrea justi tu mi amigas y yo q remos saver si tu tienes novia y cuantos años tienes y me gustaria q vinieras apartado y q no conoscamos te digo algo yo tengo 13años te amo mucho

    ResponderEliminar
  108. me encanta justin bieber...... y tmbn jaden simth x la peliii.....!!!! me vuelve loca la peli.................. xo esta cancion no dejo de escucharla de lo genial k es..... yo le dy un 10 x la cancion y x la peli... XDDDDDDDD y com dice 109 VENTE A ESPAÑA a andalucia k aki provaras ls mejores comidas de tu vidaaaaaa......... es muxooooo mejor españa k todos ls k te dicen....... te esperamooosss.... XDDDDDDDXDD tmbn a jaden simth te esparamos tmbn...

    ResponderEliminar
  109. ola soi biberzitha kierro decir k mi novio tiene mucho exitho es uno de los mejores knthanthes del mundo

    ResponderEliminar
  110. hay por supuesto que se escucha super genial
    yo abio super fan de justin bieber I LOVE YOU POR EVER JUSTIN¡¡ y que the valga ... lo que te dijan ocea por todos los comentarios que algunas personas poner de ti como tu voz es se mujer y ash cosas asi pero dejalos te tienen emvidia por que tu si eres muy guapo por que dejame decirte que no todos piensan asi hay muchas personas que te aman justin y queremos que vengas a mexico ....bueno bye I LOVE YOU jb.¡¡

    ResponderEliminar
  111. oye jaden smith se ve bien no mucho adoro la cancion es vacana

    ResponderEliminar
  112. Hola justin bieber eres lo maximo y super cool tienes que venir a honduras sigue adelante pero no te empats con selena gomez plis ay mas bonitas sabes bueno te amo: I LOVE YOU .

    ResponderEliminar
  113. hola me llamo leonela pero me dicen CARA DE MONO la verdad es que queria decirle a justin bieber si queria ser mi novio a y la cancion esta muy buena.
    soy de Honduras, Choluteca y de el colegio INBAC OSEA.

    ResponderEliminar
  114. hola justin biber me encanta tu musica y principalmente vos sos re lindo yo quiero que vengas a conocer mi pais te va a encantar seria un sueño realidad si yo pudiera conocer personalmente te amo

    ResponderEliminar
  115. me encanta ese video los dos lo hicieron super bien

    ResponderEliminar
  116. justim bieber no creas que eres el mejor en el mundo aunque tengas fama y todo no eres tan feliz como aparentas ser a un que seas muy guapo aun que le gustas a todas las chavas no boy a negar que tambien me gustas como a todas las chavas eres un amor te deseo lo mejor en tu fama y vida ojala tu vida y fama te agan felis bye!!!!justin bieber y admiradores

    ResponderEliminar
  117. Que calidad esta la letra de esta cancion esta finisima
    viva JADEN SMITH Y JUSTIN BIEBER uuuuuuuuuuuuuuuuuuuuu

    ResponderEliminar
  118. me gusta la cancion
    escuchenla en español perrros desgraciadoss
    muerancenn

    ResponderEliminar
  119. I LOVE JUSTIN,ALWAYS SMILE, HUG'S AND KISSES,TUS CANSIONES SON COOL

    ResponderEliminar
  120. HI SOY FAN TUYA HOJALA ALGUNDIA VENGAS ACA ALA CAPITAL DE MEXICO TE ADORO ERES COOL LO MAXIMO

    ResponderEliminar
  121. jajajajaja......... SE CREEN Q JUSTIN BIEBER VA A IR... A ALGUNOS DE SUS PAISES...
    JAJAJA...
    PRIMERO A ARGENTINA!!!!!!OBIO........
    PORQUE HAY LAS MUJERES MAS LINDAS... ACAAAA
    LES CABE... A TODOS|AS---

    ResponderEliminar
  122. porfi justin ben a chileee porque te amo tu cancion tu voz tu tu cara son tan bonitas
    I LOVE JUSTIN BIEBER

    ResponderEliminar
  123. adoro a justin el tiene una voz hermosa me gusta mucho BABY y NEVER SAY NEVER junto a jaden smith OJALAAA VENGAS A PERUU
    I LOVE YOU

    ResponderEliminar
  124. justin te aaaaaaaaaaaaaaamo

    ResponderEliminar
  125. chicas chicas reconosco que justin esta muy bueno pero justin no va a leer esto el no habla nuestro idioma vale pero a que esta muy bueno no ni eso esta bueniiiiiisimo
    I LOVE JUSTIN

    ResponderEliminar
  126. justin bieber me encantan tus canciones y la de baby me llego a dentro cantas mu bn y estas muyy weno. I LOVE YOU . espero k engas a españa

    ResponderEliminar
  127. si stoyyy de acuerdo cn el comentarioo numero 109 no vayas ni a chile ni peru ni na de eso vente a españaaaa k te esperamoss se te kere

    ResponderEliminar
  128. justin i like you,you sing very well and are also veru beautiful, the baby came to me in these good ....
    i love you

    ResponderEliminar
  129. Me encanta justin bieber es el mejor ojala venga a ESPAÑA a mis amigas y
    a mi nos encanta estamos siempre cantando sus canciones

    AQUI EN ESPAÑA TE ADORAMOS

    ResponderEliminar
  130. estoy con el comentario 111 vente a españa a andalucia q aqui todos te adoramos


    ANDALUCIA

    ResponderEliminar
  131. plissss go to the spain
    I LOVEE YOUU

    ResponderEliminar
  132. Justin you are very very very very ... gallant here in españa we will be waiting for you with the opened hands and I fill with enthusiasm ..! I am charmed with your voice you are very very pretty come one day to espeña to sing the income they were becoming exhausted ..;D
    JustIn..
    Ĵùstín ❤

    ResponderEliminar
  133. anjara justin no quieere salir con tigoo anda fRikíi con migo siii a si k a calllar aunke no te conosca okiis ...¡!
    BEngga fea no te agas ilusiiiones okiis..!
    Bennga xAoo
    JUstin ers el mejor muy wapo y kantaass de maraaaaaaaaaabilllas
    ttttttteeq

    ResponderEliminar
  134. Justin happens of going to bolibia, chili etc you come to españa.
    You are very very very very very very handsome sing very well and have a marvellous voice.
    I am very a your fan
    I love you, I love you

    ResponderEliminar
  135. hello me llamo johana y quiero decir que esta cancion esta padricima desde el dia en que lo bi . m gust justin bieber y chiquito pero no tanto como justin pero lo unico que yo digo es que justin never say never q never deje su talento pase lo que pase aun q digan que es gay tan soslo por la voz es absurdo que dicen algunos de el yo digo que tienen celos de el por que todas las chicas se mueren porel y el que lo insulta es un par de fenomeno por q no sabe ver chicos guapos al igual que justin bueno que se miren al espejo ante de insultar par de tarados estoy de acuer do con los que aman a justin y sigan asi bueno bye chicas y chicos gracias por su comprencion
    amooooooooooooooooooo a justin bieber x li00pre es my heart

    ResponderEliminar
  136. justin biber es el que tiene la voz mas ridicula de todos los que conozco y no es de broma
    puuuuuuaaaaaagggggggg justin das asco

    ResponderEliminar
  137. Justin bieber: eres el mejor puff...kiero ke sepa ke mi novia tekiere muxo,, Sigue asi ke tendras muxas chicas tekiero friend

    ResponderEliminar
  138. ahhh!Se me olvidaba mi tuenti es:jose david amoanatalia

    Soy de Andalucia:sevilla

    ResponderEliminar
  139. para la canción esta xevere, sobretodo con los papacitos de Jaden Smith y Justin Bieber
    me encantan los 2, pero creo que Jaden es pa' mi
    Te kiero Jaden :)eres el xico de mi vida
    Aver si vienen los 2 para Perú....Bela

    ResponderEliminar
  140. muy buen tema aunke a justin lo encuentro k canta como mujer pero bn igual pero el otro negrito weu k a a tener futuro jajja

    ResponderEliminar
  141. wOw...!! supEr la canciiOn...!!!
    jUstin TAD me encanta como caNtas, a ladO
    dEl niniitOh jadEn q es mega genial su estilO
    super cool hahaha...!! ^.^...!!
    cheiiEm...!! ^.*

    ResponderEliminar
  142. jUstin esta musica me encanta que te va&a mu& bien con tus canciones & cuidate ha eres bonito mua¡¡¡¡¡¡.....`^^^

    ResponderEliminar
  143. Amo esta cancion :D :D :D :D :D :D

    ResponderEliminar
  144. me a encantado tu letra es fantastica te kiero un monton besos muy fuertes!!
    tequiero!!!
    :)

    ResponderEliminar
  145. oOLA justin bieber cada ves mas estas mejor ..... cada dia cantas bn esta loko esta cancion al=qe todas .... justin ven a peru recuerda qe aqi tambien tiens fansss qe teqieren muchoOO tienes qe venir a pèru^^
    te qeremos justin bieber eres un amor.......^^

    ResponderEliminar
  146. oLA JUSTIN BIEBER TAMOOOOOOOOOOOOOOOOOOOOOOOOO

    ResponderEliminar
  147. Justin tio te amoo (LL)
    me encantas al pricipio no me gustabas me precias un chulito... pero empeze a ver tus videos uno por uno y me encantaste, me enamoraste (L)cantas super bien y eres una gran persona, deseo conocerte soy de valladolid españa y tengo 17 años, me encantan los animales como a ti y en la personalidad me parezco mucho a tii ;)
    deseo conocertee! aber si bienes a españa!!!
    teek (LL)

    ResponderEliminar
  148. hola justin quiero decirte que te amo con todo el corazon vente a españa te lo suplico

    I LOVE
    JUSTIN

    (L)

    ResponderEliminar
  149. I(L) JUSTIIN BIEEBEEER LO MEEEJOORRR!! TE QUIEEROO!

    ResponderEliminar
  150. si justin canta muy bien y ademas es guapo me encanta espero poder conocerlo algun dia

    ResponderEliminar
  151. justin bieber lo mejor q hay en el mundo tus canciones me facinan especialmente el primer disco q salio en el peruuuuuuuuuuuuuu

    ResponderEliminar
  152. rosa =la cristalina para ti mas nalunes, 10 enero, 2011

    hola me llamo rosa espero q algun dia vengas al peru a dar un duper mega extraordinario concierto aunq yo no iria p q no puedo ir no soy lo suficiente para pagar un boleto pero yo podria ver en las noticias .¡con muchisimo amor de rosa angelica!chamo espero q vengasssssssssssssssssssss

    ResponderEliminar
  153. awww de lOO maQziimO la qanzsiooN nu maa iegaa taan geniaaL pff la vrdd algwun dia me cazsaree cn juzstiin maa jojo bnOO aih qq zsoñar nuu? zsalee pzss bzsOOzsz Ooqq mOOaqqzzzs




    iLii juzstiin azsii aquerdenzsee de la peli 25 de marzsOOO

    ResponderEliminar
  154. me llamo valentina y tengo una amiga que se llama lucía las 2 somos las fans números 1

    ResponderEliminar
  155. Justin Bieber esta re bueno!!

    ResponderEliminar
  156. PPPPPPffff.... siii va a ir a nose donde pu*** q ya fueee
    ni haiii va a argentina de acuerdo con el comentario 125 de unaaa
    en argentinaa estamos masss buenas nosotras qqqq mmmmm.... ♥

    ResponderEliminar
  157. TU MORENITA PRESIIOSAdomingo, 27 febrero, 2011

    OLA JUSTIN TE QUIERO TU VOZ TAN HERMOSA QUE TIENES TE QUIERO OJALA QUE VENGAS A ESPAÑA O A BARCELONA I ESTAS BUENISIMO I LOVE YOU ACA LAS CHICAS SOMOS MAS HERMOSAS

    ResponderEliminar
  158. me encanta never say never y me gustaria ser amigo de ju7stin beiber

    ResponderEliminar
  159. el 163 soy yo tu fan numero uno amor y paz

    ResponderEliminar
  160. me gustaria justin que si entras a esta pagina al 163 164 y 165 lo aceptes como amigo y mandes un comentario

    ResponderEliminar
  161. este niñoo es wapiisiimoo!!! mee encantaaa!!! y ademass canta genial y es un chicoo muy umildee i love justin bieber

    ResponderEliminar
  162. justin 3s 3l mej0r l0 am0 y t0das sus cancion3s s0n sup3r c00l y 3sta wapisim0 t3 am0 justin!!!

    ResponderEliminar
  163. TODO EL MUNDO QUE DIGA QUE ES GAY ES PORQE LE TIENEN TREMENDA ENVIDIA DE TENER TODO Y SER FAMOSOS Y QUE LLENE EL GARDEN.

    EL ES MI VIDA, LO AMO, ES SUPER TALENTOSO. ES PERFECTO Y EN ARGENTINA NO HAY NADA COMPARADO CON EL .

    ResponderEliminar
  164. NUNCA AY Q DESIR NUNCA TK MUCHISIMOOOOOOOOO ALMA SIGU SIENDO TU ERES UNA GRAN PERSONA

    ResponderEliminar
  165. jostin bieber te aaaaaaaaaaammmmmmmmmmoooooooooo y siempre q sales en revistas te imajino a ty alado de mi y de hecho tengo novio pro siento k aty tanbien a ty y sy keres contestar este es mi messenyer angells_sexi07@hotmail.com

    ResponderEliminar
  166. Holaa soii saraa i tengo 14 años soi de espeña (galicia) me encantaa justin bieber eres el mejor me encantan tus canciones & tambien eres mui pero que mui guapo tendrias que venir un dia por galicia a dar un conciertoo que sepas que aqui te queremos un monton eres genial...I LOVE JUSTIN BIEBER !!!!

    ResponderEliminar
  167. te amo justin quisiera vivir comtigo te amooooooooooooooooooooooooooooooooooooooooooooo lo amigo de mi cole dicen que tu eres pajaro y nosotra las hembra la fans numero 1 decimo que nos

    ResponderEliminar
  168. justin boujor jet aime je vous souhaita venir en france

    ResponderEliminar
  169. I LOVE JUSTIN BIEBER!
    A mi me gustaria ser famoso como el tubo tanta suerte! lo admiro! lo envidio! y lo quiero mucho!

    ResponderEliminar
  170. olaaa justin biber esta cansion esta muy lindaa tkm y syempr te voy a qrer y quyero q sepas q sos muy lindooo yoop ckandela `perez colman

    ResponderEliminar
  171. justin me muero por conocerte te adoro me encantan todas tus caciones I LOVE JUSTIN BIEBER***...sueño con conocerte y si alguna vez miras a las estrellas alli estare dandote
    un millon de besos para ti**** TE QUIERO


    LORENA CESPEDES MORALES

    ResponderEliminar
  172. ME GUSTAS JUSTIN CANTA MUY BONITO OJALA VINIERAS A PERV

    ResponderEliminar
  173. es un gran bobo encreido cree que con su cara conquista a todos

    ResponderEliminar
  174. ami por lo normal me encanta jaden smith; ¡oye guapo si tu jaden smith! si ves esto te paso mi msn ok es akemy98lopez@live.com.mx pues asi podremos conversar hacerca de nosotros ok guapo nos vemos por favor revisa esta pagina es muy importante te quiero xoxoxoxox tu amiga ................. buscame ok pronto me veras por alla o vienes por mi aqui te espero bye xoxoxoxo..

    ResponderEliminar
  175. CANTA MUY BIEN NO me quejo

    ResponderEliminar
  176. joe como os liais a hablar y unas cuantas cosas:
    -dejar ya de echarle flores por q tampoco es para tanto.
    -hijos mios,ni voz hermosa ni leches a ver os enterais de q existen los retoqes o q os creeis q canta asi.
    -por,cierto menuda voz de niña q tiene.
    -y,os gusta el?bbbuuuaaaajjj!!!
    pero si es un feto,vaya pelo q tiene parece un casco.
    -y la ropa...
    con la capuchita esa q se pone esta ridiculo y las gorras lo mismo digo.
    no pierdo mas el tiempo con vosotros a si q adios.
    y...

    el hijo de will smith por lo menos es normal no como el justin de las narices.
    ah y la anonima del 28 de marzo q dejo su msn:
    akemy98lopez@live.com
    no pongas tu msn o lo q sea en internet q luego lo pilla un pederasta y la lias y deja ya de soñar q no va a venir jaden smith y va a coger el msn por qe tu le importas una mierd* te enteras
    adios pringaos

    ResponderEliminar
  177. justin sos el mejor artista del mundo aunque jaden smith no se queda atras... te amooooooooooo justin sos mi vida sos hermoso,cool...sos perfectoooooo te amo ah y jaden smith tambien es hermoso!!! bye bye

    ResponderEliminar
  178. Me gusta mucho esta cancioon ;)
    Y eso que no soy ala una fanatica de justin pero si meg suta ♥

    ResponderEliminar
  179. esta cacion es chevre mui biena hojala venge aca a guayaquil

    ResponderEliminar
  180. Hola justin mencantaria k lelleras este mensage pero creo k es imposible amas tu no entiendes español.

    Me llamo marina i soy una de tus mayores fans.

    cuando vendras a barcelona?¿ :)

    I LOVE YOU!!!!!!!

    ResponderEliminar
  181. Yo diigo !! q es la primera cancion de justin q me facina solo por Jaden :D !!!

    ResponderEliminar
  182. ya ya ya toooooooooooooodo para justin pero creo k jaden se merece un buen aplauso creedme es grande lo se....

    ResponderEliminar
  183. me encanta justin drew bieber es el mejor junto con jaden smith usher and justin timberlake ven a sevilla justin

    ResponderEliminar
  184. wuao amooooo a justin y a jaden I love chicos cantan super jb eres un papacito y jaden eres super lindo los amoooooooooo.... <3 <3 <3

    ResponderEliminar
  185. chicas si son stupidas pierden su tiempo en jb. esoo se los digo por que jb es mi novio ok haci que callence los dedos (las bocas)... el es mio y de nadien mas ok..... hay mi amor acuedate que mañana me regreso a california te amo novio.....

    ResponderEliminar
  186. tu eres la estupida re mamagueva me imagino que nisiquiera conoces a jb..
    te amo jb

    ResponderEliminar
  187. de verdad eres una re mamagueva te odio maldita coño de tu madre me imagiino que tu madre te enseño a ser mentirosa te odio mamagueva re puta....
    Ilove justin y jaden

    ResponderEliminar
  188. @de jb

    estupidas crias peliando entre si ! es obio que una obessiva y la otra una mentirosa dudo mucho que sea tu novio si es el novio de selena gomez punto uno punto dos no creo que sepas ingles si no como lo conocerias ? pateticas

    ResponderEliminar
  189. hola justin me llamo pame y mi mejor amiga yane somos re pero re fanaticas tuyas yo tengo 11 años y yane tiene 10 años te amamooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo con todo mi corazoooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooon

    ResponderEliminar
  190. el anonimo que contesto lo que escribi que jb es mi novio eso es verdad y yo si hablo ingles y la otra chica que me ofendio disculpa pero en ningun momento me meti con tigo solo dije la verdad jb te amo mi amor.

    ResponderEliminar
  191. disculpa de jb pero solamete escribi eso por que me molesto tanto lo que pusiste este ummm vamos hacer amigas si...

    ResponderEliminar
  192. justin es el mejor en toda la faz de la tierra y el genial
    I love justin bieber lo amo muchisisisisisisisisisisimoo
    el es mi novio ja!

    ResponderEliminar