JUSTIN BIEBER - Never Say Never [Letra, Traduccion y Video] SOUNDTRACK KARATE KID

   Comentarios FB Comentarios  Comentarios 223 Comentarios   Fecha1 de jun. de 2010    


See I never thought that I could walk through fire.
I never thought that I could take the burn.
I never had the strength to take it higher,
Until I reached the point of no return.

And there’s just no turning back,
When your hearts under attack,
Gonna give everything I have,
It’s my destiny.

I will never say never! (I will fight)
I will fight till forever! (make it right)
Whenever you knock me down,
I will not stay on the ground.
Pick it up,
Pick it up,
Pick it up,
Pick it up up up,
And never say never.

I never thought I could feel this power.
I never thought that I could feel this free.
I’m strong enough to climb the highest tower.
And I’m fast enough to run across the sea.

And there’s just no turning back,
When your hearts under attack,
Gonna give everything I have,
Cause this is my destiny.

I will never say never! (I will fight)
I will fight till forever! (make it right)
Whenever you knock me down,
I will not stay on the ground.
Pick it up,
Pick it up,
Pick it up,
Pick it up, up, up,
And never say never.

Here we go!
Guess who?
JSmith and Jb!
I gotcha lil bro.
I can handle him.
Hold up, aight?
I can handle him.

Now he’s bigger than me,
Taller than me.
And he’s older than me,
And stronger than me.
And his arms a little bit longer than me.
But he ain’t on a JB song with me!

I be trying a chill
They be trying to side with the thrill.
No pun intended, was raised by the power of Will.
Like Luke with the force, when push comes to shove.
Like Cobe with the 4th, ice water with blood.

I gotta be the best, and yes
We’re the flyest.
Like David and Goliath,
I conquered the giant.
So now I got the world in my hand,
I was born from two stars
So the moon’s where I land.

I will never say never! (I will fight)
I will fight till forever! (make it right)
Whenever you knock me down,
I will not stay on the ground.
Pick it up,
Pick it up,
Pick it up,
Pick it up, up, up,
And never say never.

I will never say never! (I will fight)
I will fight till forever! (make it right)
Whenever you knock me down,
I will not stay on the ground.
Pick it up,
Pick it up,
Pick it up,
Pick it up, up, up,
And never say never.

I will never say never! (I will fight)
I will fight till forever! (make it right)
Whenever you knock me down,
I will not stay on the ground.
Pick it up,
Pick it up,
Pick it up,
Pick it up, up, up,
And never say never.

[Traducida al Español]

Mira, yo nunca pensé que podría caminar sobre fuego
Nunca pensé que podría quemarme
Nunca tuve la fuerza para llevarlo mas alto,
Hasta que llegué al punto de no regresar

Y simplemente ya no hay vuelta atrás,
Cuando tu corazón te da un golpe bajo
Voy a darte todo lo que tengo,
Este es mi destino.

¡Yo nunca diré nunca! (Voy a luchar)
Voy a luchar por siempre! (Hacerlo bien)
Cada vez que me derribes,
No me quedaré en el suelo.
Me levantaré,
Y nunca digas nunca.

Nunca pensé que podría sentir este poder.
Nunca pensé que podría sentirme libre.
Soy lo suficientemente fuerte para subir a la torre más alta.
Y soy lo suficientemente rápido para correr y cruzar el mar.

Y simplemente no hay vuelta atrás,
Cuando tu corazón te da un golpe bajo
Va a darte todo lo que tengo,
Porque este es mi destino.

¡Yo nunca diré nunca! (Voy a luchar)
Voy a luchar por siempre! (Hacerlo bien)
Cada vez que me derribes,
No me quedaré en el suelo.
Me levantaré,
Y nunca digas nunca.

¡Aquí vamos!
¿Adivina quién?
JSmith y JB!
Te tengo lil bro.
Puedo manejarlo
Espera, Hey?
Puedo manejarlo.

Ahora él es más grande que yo,
Más alto que yo.
Y es mayor que yo,
Y más fuerte que yo.
Y sus brazos son un poco más grandes que yo.
Pero él no está con JB canta conmigo!

Yo intentando un escalofrío
Ellos tratan de ponerse al lado de la emoción.
No es un juego de palabras, fue criado por el poder de la Voluntad.

Al igual que Lucas, con la fuerza, cuando empuje vendré empujar.
Al igual que Cobe con el 4 de Julio, con la sangre.

Tengo que ser el mejor, y sí
Vamos a volar más alto
Al igual que David y Goliat,
I conquistar al gigante.
Así que ahora tengo el mundo en mi mano,
Nací de dos estrellas
Así que la luna esta sobre la tierra.

¡Yo nunca diré nunca! (Voy a luchar)
Voy a luchar por siempre! (Hacerlo bien)
Cada vez que me derribes,
No me quedaré en el suelo.
Me levantaré,
Y nunca digas nunca. (x2).
   Comentarios FB Comentarios  Comentarios 223 Comentarios   Fecha1 de jun. de 2010    

223 comentarios

Click para Comentar «El más antiguo   ‹Más antiguo   1 – 200 de 223   Más reciente›   El más reciente»
martes, 01 junio, 2010 ×

ámo a justin bieber espero ke algun dia benga a mexico

martes, 01 junio, 2010 ×

me parece demaciado buena esta cancion
justin ojala pueda venir a colombia

martes, 01 junio, 2010 ×

las canciones de justin bieber son muy buenas jamas habia conocido a alguien con una voz tan hermosa y ademas el ritmo de sus canciones son muy originales y geniales!!!!


martes, 01 junio, 2010 ×

esta mui buena la cancion
suerte en su talento de justin bieber
ojala que venga a peru pz!! aver si se anima

We will welcome you if you decide to come to peru

martes, 01 junio, 2010 ×

que vonito juston me encanta sigue p`ssssssssssssssssssssssssssssssssssssssssssssssssss tu tambien jaden smith

miércoles, 02 junio, 2010 ×

adoro la canciionnn!!! (L)

miércoles, 02 junio, 2010 ×

jajajaja .... al parecer a j.b. le esta cambiando la voz ....q bn q bonix esta su cancion ....el esta re lindo esta mas grande....me gustan todas sus canciones....hehehe...espero q justin bieber venga a Guatemala q se recuerde q aqui tambn tiene fans y q lo queremos ... justin bieber veeeen por fiiis....=)..!!

miércoles, 02 junio, 2010 ×

justin es bkn el todo es tan real no es falso sigui igual ke siempre no cambia su adolencia sigue haci te amamos haci cm eres

miércoles, 02 junio, 2010 ×

me encanta justin pero me facino como rapio jaden smith
la cancion esta realmente buena....

miércoles, 02 junio, 2010 ×

AMOH a justin biebeeR suu musicaa es geniaaL Y me encntaa su voz aunqee cambiee
tdas suus cancioonees soon ReeaLmntee geniaLees y estaa estade masiadooo bnaahh =) me a mucho gusto qe sigaa y su voz ezta ermosaa

jueves, 03 junio, 2010 ×

justin beiber esta bien pero lo malo es k, se paso de la raya e escuchado k se esta com parando con bandas recontra conocidas como TOKIO HOTEL , JONAS BROTHER, bueno son buenas tambien pero no creo k sea tanto, pero si sale sobre green day o linkin park va a perder

domingo, 06 junio, 2010 ×

me encantas justin beber tus canciones,tu voz,todo todo...eres genial espero que sigas asi :) y te des una pasadita a PerÚ ;)

lunes, 07 junio, 2010 ×

uuuufffff justtinn no no noo es hermosooooo y lo aamo perroo yoo diggo q jordan smith sera mejor q justin por q nos dejo sorprendidoss pero bnoo justin nuca dejara de ser cuapo yy bnoo ssu musica me encanta haahha bno besoss byebye

martes, 08 junio, 2010 ×

Wooo lOS Dos Hacen un duo dinamico... me encantan y justin osea super Beiio i love My baby

miércoles, 09 junio, 2010 ×

me encanta justin bieber es mi novio hehe amm y la cancion tbm a y tbm jaden smith 0ok byebye

miércoles, 09 junio, 2010 ×

am0o0o0o0o0o0o0o a justin bieber hehe y me encanta la cancion a y tbm jaden smith

miércoles, 09 junio, 2010 ×

w0ola I LOVE YOU JUSTIN BIEBER me necantan todas sus cancionex mi preferida es la d eenie meenie pr0o esta tbm esta genial como todo lo de el haha byebye y ojala q algun dia justin bieber vanga a mexico bye

viernes, 11 junio, 2010 ×


viernes, 11 junio, 2010 ×

te amo justin es mio no se los presto es mio mio mio mio mio mio mio mio mio mio mio mio 4 ever

sábado, 12 junio, 2010 ×

hey justin ere sel mejor te amo

sábado, 12 junio, 2010 ×

justin bieber se pudre de guapo y cody simpson se queda abajo quiero que vengas a ecuador y que sepas que aqa tambien tienes fans y yo soy una de esas

lunes, 14 junio, 2010 ×

Amo aa justin Bieber es el mejor sus musiks son buenisimas ... adore la nueva cn jaden ta cool spro q gane =)

sábado, 19 junio, 2010 ×

me parece una completa falta de tiempo escuchar a alguien tan pero tan carente de algun tipo de pensamiento...no tiene ni voz linda ademas de mujer es esa vos... tiene una apariensia denigrante... con un look espantosamente poco varonil...rodeado de una situacion de auntentico retardadooo... como les puede gustar un chiquito que tiene vos de mujer...
y sin sentido las canciones
aprendan un poco de musica

domingo, 20 junio, 2010 ×

callate vos anonimo justin es re lindo y no canta como mujer y el peinado es lo mas lindo de el no perdemos el tiempo escuchando porque nos encanta a las mujeres vos decis eso porque estas celoso de que las mujeres gusten de le y no de vos seguro que sos re feo y gordo

lunes, 21 junio, 2010 ×

Q hermoso que es algun dia que venga a la argentina ♥ segui assi justin YEGARAS MUY ALTO♥

lunes, 21 junio, 2010 ×

justin muy talentoso siga asiii !!....jaden smith si va hacer como su padre llegara lejos muy buen actor ..la cancion demaciadamente brutal!!!justin ojala un dia visites Puerto Rico

lunes, 21 junio, 2010 ×

jum muy solprendida los dos me encantan pero jade smith me facina es vdd que si sigue asi va muy bien y la pelicula ni se diggaaa super brutal..!!!pero espero que algun dia los dos visiten a puerto rico!!!

lunes, 21 junio, 2010 ×

buen sonido

lunes, 21 junio, 2010 ×

huy dios mio sra que justin no es gay es demasiado lindo mua, ademas canta divino y sabes me gustan mucho tus pintas

martes, 22 junio, 2010 ×

bien!! me encanta la cancion! es mi preferida! canta de puta madre! y k sepais a los k no lo saben....YA LE HA CAMBIADO LA VOZ!! ES ESTA! COMPARAR ESTA CON LA DE BABY!
jaden para mi canta bien, pero nada comparado con justin!
justin a ganado a los jonas!! toma toma toma! si esk justin no le supera nadie!! muahaha
a y una cosa, kien le insulte, antes k se mire al espejo vale retrasaos?!¬¬'

martes, 22 junio, 2010 ×

amo a justin bieber su musica es lo mejor del mundo dice cosas lindas y emocionantes!!!!
canta bn baila bn es lo mejor del mundo

viernes, 25 junio, 2010 ×

en español:el significado de esta cancion es q nunca te des por vencido y sigue adelante.nunca digas nunca

In English:The meaning of this song is never q you des for conquered and continues adelante.never say never

viernes, 25 junio, 2010 ×

i am from Argentina and I love all the songs justin, is Hermes also sings and dances really good and hopefully I will leave some day come ah Argentina

viernes, 25 junio, 2010 ×

aii justinn VENITE A ARGENTINA♥ me encanta la cancion!!
aiaiai pero jaden smith no se qeda atrass lo adoroo a jadenn!!♥♥ i justin buenoo qe decir de voos! ya lo dijieron toodoo!=D

sábado, 26 junio, 2010 ×

en realidad no me gusta demaciado la musica de justin bieber,, pero en realidad me gustaria qee vieniera a colombia con j smith i qe canten esta cancion en su concierto

sábado, 26 junio, 2010 ×

ufff ese niño esta relindo
********* justin bieber ven a colombia porfabor*******
mucha estupida la que no crea o la que no acepte que justin es super talentoso y relindo
:) ven a colombia te estare esperando junto con todo mi pais

domingo, 27 junio, 2010 ×



domingo, 27 junio, 2010 ×

es super linda esta cancion y si quieren hablar con el creen su twitter pero es algo imposible q les conteste q cole gggggggg

lunes, 28 junio, 2010 ×


martes, 29 junio, 2010 ×

tengo el msm de justin bieber !!!!ahhhhhhhhhhhh y puso cam es bn lindo

jueves, 01 julio, 2010 ×

I love justin bieber !! please dame ese msn soy inglesa pero se hablar un poco de español porque mi prima es de ahii please and i te doy el de selena gomez si te interesa okk
!! (L)

jueves, 01 julio, 2010 ×

me encanta como canta y lo que dicen sus canciones =)

citlalli itzel
sábado, 03 julio, 2010 ×

justin bieber eres lo mejor eres mi idolo por sorpresa
te amooooooooooooooooooooooooooooooooooooooooooooooooooooooo te kierooooooooooooooooooooooooooooooooooooooooooooo y te adorooooooooooooooooooooooooooooooooooooooooooooo

responde aeste comentario mi messenger es
asi como esta escrito

sábado, 03 julio, 2010 ×

Esta buena la canción, debe de ser la unica canción de justin bieber que me atrae, ya que en el resto de sus canciones no he notado argumento ninguno.
Y que no se esfuerze ninguna de las chicas o chicos que lo admiran, en insultarme o tratar de ofenderme de alguna forma por mi comentario, ya que no creo que vuelva a entrar otra vez a esta página en mi vida (Ya que ya obtuve la información que necesitaba de la misma).
Por otra parte, en el momento que veía la película, al escuchar la canción, pense que la cantaba una mujer y nadie puede decir que su voz no tiene un ligero toque de afemeneidad el cual se nota cuando canta.
Para terminar hablare de JS (jaden smith), lo primero que debo destacar es que ha diferencia de justin, la primera vez que lo escuche cantar (que seria esta) me gusto y mucho, lo segundo que dastaco y lo ultimo es la fluidez y lo bien que sabe bailar y actuar, tal como lo hace en su pelicula.

domingo, 04 julio, 2010 ×

joooodeer .. loo siientoo por laas palabrootas .. :/ ..
soii de la paterna .. de las palmas de gran canarias ..
yo quisiera que justin bieber viniera a la isla de gran canarias dar un concierto =( ..
para que el si vea las fans que tiene aqui se ba a kedar sorprendido ='(..
no se por que cuando veo a justin en algun video clips me pongo nerviosa , tal vez por que aparteee deee que es guapisimooo (baba)
kee es el en el uniico kee mee eh fijado en las muecas ke ase :/ ..
cuando canta me eh fijado en su corazon (heart)

domingo, 04 julio, 2010 ×

me encanta esta cancion justin te aaaaaaaaamoooooo ven a peru pliiiiiisss

domingo, 04 julio, 2010 ×

o0ig@n yo0 digo0 k justin es lo0 mejo0r lo0 ado0ro0 es lo0 maximo0 y es wapisimo0 o0 saludo0s pasatela chido0 o0k bye

lunes, 05 julio, 2010 ×

Hi Justin're great, I'm your fan number one, you're handsome and I love your personality
you should come to Spain for a concert, and do not let others take away the post you have only envy. I love you I´m Lety.

lunes, 05 julio, 2010 ×

justin me encanta tu musica y me encantarias que vengas al ecuador y me encanta esta cancion te deseo mucha suerte en tu carrera te amo muchoooooooooooo chao

lunes, 05 julio, 2010 ×

waaa no manshess
k hermosaa
d me noveo

sii me ennkantha
komo kantha ii
no manshess
lo k diicenn suss
letrass waaa
me iiego =´D


martes, 06 julio, 2010 ×

waaaaaapoo-i love you m nkantan todas tus canciones

viernes, 09 julio, 2010 ×

Osea Justin Biber no es lindo feo... es normal... me gustan alguna de sus canciones.. pero ta tampoco es q me muera x el..
Jadem Smith es un amor ese niñoo!! jaja va a llegar muy lejos
Demas la cancion never say never ;)

viernes, 09 julio, 2010 ×

si la verdad es que justin es muuy bonito.. bah es un bombon pero jaden en verdad tiene lo suyo... son bonitos los dos, aunque Jaden es menos lindo que Justin.
En verdad concuerdo un poco con el o esa (creo que es el porque re insulto a Justin) de que la voz no es muuuy de macho(de hombre maduro) pero bueno cada uno tiene su voz y cada uno tiene sus gustos). Ademas es un nene,tiene 16 años, bueno yo tengo 14 pero digo de que no es como Zac Efron que tiene 22 entienden, es mas chico , por lo tanto la voz no es de hombre adulto. Y es verdad la voz de justin cambio de Baby a Never Say Never.
La cancion Never Say Never te da una muy buena leccion. Te hace pensar y darte cuenta de muchas cosas. Jaden Smith se pasa me encanta como baila!!! ¿Cuantos años tiene Jaden? Parece de 9 o 10 . En la pelicula Karate Kid hace de 12 pero me da sensacion de que es mas chico.
Bueno yo espero que Justin venga a Uruguay. Nadie lo debe conocer, pero es un pais que esta al lado de Argentina y abajo de Brasil.Es muy chiquito el pais pero somos grandes de corazon jaja
Un beso para todos y todas los/as que comentaron . Porrque aunque algunos hayan insultado a JB y JS me caen bien porque dicen lo que piensan
Chauusiito Aby

domingo, 11 julio, 2010 ×

AMO A ESTA CANCION !!!!!!!!!!!!!!!!!!!!!!!!!!!!!1

lunes, 12 julio, 2010 ×

I love you justin bieber and jaden Smith!♥♥
ojala que vengan a Culiacan,Sinaloa
me encanto la pelicula de karate kid
tambien me encanto la cancion


martes, 13 julio, 2010 ×

k buena cancipn me encantas justi I LOVE JUSTIN

jueves, 15 julio, 2010 ×

esta cancion es sper me encata justin bieber y me gustaria q algun dia venga a Peru

viernes, 16 julio, 2010 ×

te amo justin sigue asi nunka termines de enamorarnos con tu voz (i love you justin drew bieber malette) my beautiful boy tee amo con todo mi corazon te tengo en mi vida (life)

lunes, 19 julio, 2010 ×

hola t amo justin quiero ser t fans numro#1 t amo te quiero haaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
t amo quiero sigue asi I love sigue asi
te amo qeria q yo sea tu novia pero ya tienes

si contesta contesta a mi

lunes, 19 julio, 2010 ×

la cancion de never say never es muy bonita me guta sigue asi justin XD

martes, 20 julio, 2010 ×

k pasada de cancion !!!!!!!
mola pilaaa!!!!!!!!!!

jueves, 22 julio, 2010 ×

justin es el mejor que ggaaa

brenda jaiel
jueves, 22 julio, 2010 ×

justin eres el mejor te qm espero que vengas a mexico

martes, 27 julio, 2010 ×


martes, 27 julio, 2010 ×

espero que justin vanga a ecuador

jueves, 29 julio, 2010 ×

justin es guapisimo papacito

viernes, 30 julio, 2010 ×

PLEASE VENI A LA ARGENTINA!!!!!!!!!!!!!!!!!!!!!

viernes, 30 julio, 2010 ×

hay no ksi me muero cuando te veo justin eres el mas guapo pero guapo del mundo, te amo espero que no tengas novia, por q aqi esta tu bombon. me enkntan ts videos, canciones y demas. todo tu eres un cuero bien hecho. ojala hables aunq sea un poco de español y leas esto porq para mi es muy importante.ojala vengas a mexico gdl. te amooooooooo ILOVE JUSTIN BIEBER ILOVE YOU

sábado, 31 julio, 2010 ×

mvy vacan esta cancion ajola q jostin pveda venir aqvi a PERV pes<<<<........

sábado, 31 julio, 2010 ×

amo a jaden smiith es lo mjor justin kmo k iia paso de moda iia stha biejitho ande no amo a JADEN SMITH

domingo, 01 agosto, 2010 ×

esta superguay justin sus canciones son geniales es el mejor insuperable siiiiiiiiiiiiiiiiiiiiii viva justin.

martes, 03 agosto, 2010 ×

justin bieber ojala que vengan a peru te
amo eres muy lindo

miércoles, 04 agosto, 2010 ×

Justin Bieber vendra a Perú pero lo hara cuando ya no tenga fama cuando ya casi nadie lo recuerde ...el visitará Sudamerica cuando ya no tenga fama pero quien lo adora como yo nunca lo olvidara y guardara sus canciones en un lugar especial en su mente...XD
Jaden eres el mejor...besitos

viernes, 06 agosto, 2010 ×

Mee encanta JUSTIN BIEBER, me fascinan sus canciones y sobre todo esta.."NUNCA DIGAS NUNCA"..
Una amiga miia se muere por el, me encantaria que venga a TENERIFE y le compro una entrada, me querria para toda la vida jajajajaajjajja...¡¡¡¡

viernes, 06 agosto, 2010 ×

ooooooooooooooooooohhhh... mijito ricooo, te kero mucho justin bieber, te amo, te adoro, me encantan todas tus canciones, pero por sobre todo never say never, ery los mas lindo en todo el planeta, teni una voz filete, y ke se pudran todos los ke te critican por tu voz, por tu frma de ser, a los gais nadie los molesta por ser como son, ¿por ke a ti si? ¿si al final tu no eres gay? too lo contrario eri el mas hombre de too, eri lo mas lindo en todo el planeta,eri lo mas lindo ede la fas de la tierra, no entiendo porke te critican tantoo, si no te conocen lo demasiado, como para hablar tantas estupideses de ti.




sábado, 07 agosto, 2010 ×


domingo, 08 agosto, 2010 ×

hola justin bieber me llamo renata me gusta esta cancion cuando vas a venir a peru

domingo, 08 agosto, 2010 ×

ola justin me llamo catalina soy fans numero 1 de ti eres lo mejor de todos cuando vas a venir a chile te esperamos ojalas que vengas chao cuiidate besitos

domingo, 08 agosto, 2010 ×

justin bieber te amo muxo eres lo mejor del pop ii cantas con mushio sentimiento te amo te amo te amo eres solo miomiomiomiomiomio te kiero kaleta

Diana esquer Melissa acuña : )
domingo, 08 agosto, 2010 ×

ojala que puedas venir aser un consierto en hermosillo sonora mexico .

lunes, 09 agosto, 2010 ×

justin bieber te quiero mucho como quisiera q agas un concierto en peru y la mejor cancion q me gusta es babi te quiero mucho

lunes, 09 agosto, 2010 ×

jajaja!!! apuesto que todos los que dejan estos mensajes solo son torpes chicas ilucionadas con el y uno que otro gay jajajaja!!!! adema ustedes no saben que el nisiquieras sabe k existen entiendanlo de una ves firma:alguien.

lunes, 16 agosto, 2010 ×

never say neverr...klaro staaa...i love you justinn !!!

lunes, 16 agosto, 2010 ×

amo a just para mi el es perfecto y nadie me pued acer cambiar de opinion q copa2 el tema never say never nunca cambies justinnnnnnnn

miércoles, 18 agosto, 2010 ×

justin te amoooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo Y LOVE JUSTIN TE AMAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA SONIA.

miércoles, 18 agosto, 2010 ×


miércoles, 18 agosto, 2010 ×

hola justin soy juan de costa rica y tengo 19 y me encanta tu musica mas la de never say never

miércoles, 18 agosto, 2010 ×

hola q tal , soy peruana y tengo 13 , me gustaria q JUSTIN BIEBER venga a peru . buena cancion q hicieron , buen duo con JADEN SMITH . tienen mucho futuro , ojala se animen .no lo olviden porfa ok , chauuu

sábado, 21 agosto, 2010 ×

justin bieber me gustan tus canciones espero q vengas al peru especialmente a trujillo para deleitar tus hermosas canciones q x sierto ia me las se bueno un poco

sábado, 21 agosto, 2010 ×

me encanto bastante la letra de la cancion,....tiene un significado muy bello y creo q sus vidas estan reflejadas en esta cancion ....
jb jamas se imagino tener la fama que tiene y llegar a donde llego y mirenlo aqui esta ...porque ...el nunca dijo nunca y espero que sea un ejemplo para cada una de las personas

sábado, 28 agosto, 2010 ×

mee encantaa estaa canción es muu bonitaa!!! y sobre todo me encanta justin bieber y jaden smith ojalaa k vengan a andaluciaa!!

martes, 31 agosto, 2010 ×

me encanta sta cancion es 1 se mis favoritas justin es l mejor artista k scuchado seria muy bonito k pueda venir s bolivia lo adoro muchos besos y suerte en tu carrera t amo!!!!!!

martes, 31 agosto, 2010 ×

hola justin t amo eres realment hermoso sabes nunka m cansare de oir tus canciones tengo miles de fotos de ti en mi cel y n special tus canciones no dejar de oir tys canciones t adoro IIII LOVE YOU!!!!!!!! ATTE Angi

miércoles, 01 septiembre, 2010 ×


viernes, 03 septiembre, 2010 ×

I LOVE J & JB !!!!!!!!

viernes, 03 septiembre, 2010 ×

creo que todas estamos de acuerdo en que justin bieber es un papacito y que cualquier chica estaria encantada de ser su novia
I LOVE YOU MY BABY JUSTIN BIEBER!!!!!!!!!!!!!!!!!!!!!1

viernes, 03 septiembre, 2010 ×

ammmmmo a justin....justin veni porfavor aca en paraguay...yo si o si voy a tu concierto...si era por mi le mataria al q t tiro la botella...aca en PY t amamos somos muy solidarios aca...nosotros aca ayudamos y porfavor veni...y vas a ver q si es q venis aca t vamos a tratar como sifueras parte del PY...t amamos!!!

sábado, 04 septiembre, 2010 ×

hola soi galilea me encanta el vide o de never sai neber

lunes, 06 septiembre, 2010 ×

i love u 4ever JUSTIN..... <3!!!!!
diox jaja (princesaleidy@hotmail.com)

martes, 07 septiembre, 2010 ×

amOoOoo A JUSTINN ES Lo MAS y cOn esta sOn en seriO descriibe lO q en estOs momentos estOy pasandO estOy en ua etapa en la q tube q tOmar una duficil deciciOn y sOlO esO tengO q ser fuerte y nO dejarme derribar pOr q estar lejOs de tu familia y amiigOs nO es cosa faciil

miércoles, 08 septiembre, 2010 ×

me encanta jaden smith (L)

viernes, 10 septiembre, 2010 ×

Justin Bieber es guapisimo pasate por españa o Por cantabriaaaa

viernes, 10 septiembre, 2010 ×

yo soy la fan numero 1, tengo el acolchado posters cortina utiles todoas sus canciones y me las se y cunado venga a la tinoamerica no me importa q sea peru, bolibia, chile, brasil etc yo voy a biajar y lo voy a ver pero es mejor q vengaa la argentina en fin justin bieber te amooooooooooooooo coon toda mi alma pienso en vos todos los dias y aveces sueño con el!! una vez soñes q estaba en mi escuela y me dio un artografo y despues me case con el en fin q raro :)!! no?? pero los sueños son asi´! a y me olide de contar q el q traia los anillos era un mono jajaja besos a las chicas q les gusta

lunes, 13 septiembre, 2010 ×

Amo a Jaden Smith! ♥

lunes, 13 septiembre, 2010 ×

me gusta justin bieber sus canciones son bonitas??????????????????????????????????????jajajajajajaja............

viernes, 17 septiembre, 2010 ×

hola yustin bieber te amo soy tu fan yespero que vengasa al peru muy prontote quieroooooooooo....

domingo, 19 septiembre, 2010 ×

Justin te amo espero que algun
dia vengas y me conoscas

martes, 21 septiembre, 2010 ×

hola justin drew bieber ya se q no te gusta el cholate ni el helado te encanta la musica de ne-yo, eres lindo me encanta tus canciones me gustaria visitarte en canada me guasta como toas la guitarra,el piano,bateria,y la trompeta.

miércoles, 22 septiembre, 2010 ×

justinn ni mexico ni peru ni chile ni mierdas d estas ventee a españa coñoo q es lo mejorr y siempre t esperaremosss!!

miércoles, 22 septiembre, 2010 ×

andrea justi tu mi amigas y yo q remos saver si tu tienes novia y cuantos años tienes y me gustaria q vinieras apartado y q no conoscamos te digo algo yo tengo 13años te amo mucho

miércoles, 22 septiembre, 2010 ×

me encanta justin bieber...... y tmbn jaden simth x la peliii.....!!!! me vuelve loca la peli.................. xo esta cancion no dejo de escucharla de lo genial k es..... yo le dy un 10 x la cancion y x la peli... XDDDDDDDD y com dice 109 VENTE A ESPAÑA a andalucia k aki provaras ls mejores comidas de tu vidaaaaaa......... es muxooooo mejor españa k todos ls k te dicen....... te esperamooosss.... XDDDDDDDXDD tmbn a jaden simth te esparamos tmbn...

jueves, 23 septiembre, 2010 ×

ola soi biberzitha kierro decir k mi novio tiene mucho exitho es uno de los mejores knthanthes del mundo

viernes, 24 septiembre, 2010 ×

mejor canta tongo

sábado, 25 septiembre, 2010 ×

hay por supuesto que se escucha super genial
yo abio super fan de justin bieber I LOVE YOU POR EVER JUSTIN¡¡ y que the valga ... lo que te dijan ocea por todos los comentarios que algunas personas poner de ti como tu voz es se mujer y ash cosas asi pero dejalos te tienen emvidia por que tu si eres muy guapo por que dejame decirte que no todos piensan asi hay muchas personas que te aman justin y queremos que vengas a mexico ....bueno bye I LOVE YOU jb.¡¡

domingo, 26 septiembre, 2010 ×

oye jaden smith se ve bien no mucho adoro la cancion es vacana

miércoles, 29 septiembre, 2010 ×

Hola justin bieber eres lo maximo y super cool tienes que venir a honduras sigue adelante pero no te empats con selena gomez plis ay mas bonitas sabes bueno te amo: I LOVE YOU .

miércoles, 29 septiembre, 2010 ×

hola me llamo leonela pero me dicen CARA DE MONO la verdad es que queria decirle a justin bieber si queria ser mi novio a y la cancion esta muy buena.
soy de Honduras, Choluteca y de el colegio INBAC OSEA.

miércoles, 29 septiembre, 2010 ×

hola justin biber me encanta tu musica y principalmente vos sos re lindo yo quiero que vengas a conocer mi pais te va a encantar seria un sueño realidad si yo pudiera conocer personalmente te amo

viernes, 01 octubre, 2010 ×

me encanta ese video los dos lo hicieron super bien

lunes, 04 octubre, 2010 ×

justim bieber no creas que eres el mejor en el mundo aunque tengas fama y todo no eres tan feliz como aparentas ser a un que seas muy guapo aun que le gustas a todas las chavas no boy a negar que tambien me gustas como a todas las chavas eres un amor te deseo lo mejor en tu fama y vida ojala tu vida y fama te agan felis bye!!!!justin bieber y admiradores

jueves, 21 octubre, 2010 ×

Que calidad esta la letra de esta cancion esta finisima
viva JADEN SMITH Y JUSTIN BIEBER uuuuuuuuuuuuuuuuuuuuu

sábado, 23 octubre, 2010 ×

me gusta la cancion
escuchenla en español perrros desgraciadoss

domingo, 24 octubre, 2010 ×


domingo, 24 octubre, 2010 ×


domingo, 24 octubre, 2010 ×


viernes, 29 octubre, 2010 ×

porfi justin ben a chileee porque te amo tu cancion tu voz tu tu cara son tan bonitas

viernes, 29 octubre, 2010 ×

adoro a justin el tiene una voz hermosa me gusta mucho BABY y NEVER SAY NEVER junto a jaden smith OJALAAA VENGAS A PERUU

sábado, 30 octubre, 2010 ×

justin te aaaaaaaaaaaaaaamo

sábado, 30 octubre, 2010 ×

chicas chicas reconosco que justin esta muy bueno pero justin no va a leer esto el no habla nuestro idioma vale pero a que esta muy bueno no ni eso esta bueniiiiiisimo

lunes, 01 noviembre, 2010 ×

justin bieber me encantan tus canciones y la de baby me llego a dentro cantas mu bn y estas muyy weno. I LOVE YOU . espero k engas a españa

lunes, 01 noviembre, 2010 ×

si stoyyy de acuerdo cn el comentarioo numero 109 no vayas ni a chile ni peru ni na de eso vente a españaaaa k te esperamoss se te kere

martes, 02 noviembre, 2010 ×

justin i like you,you sing very well and are also veru beautiful, the baby came to me in these good ....
i love you

viernes, 05 noviembre, 2010 ×

Me encanta justin bieber es el mejor ojala venga a ESPAÑA a mis amigas y
a mi nos encanta estamos siempre cantando sus canciones


sábado, 06 noviembre, 2010 ×

estoy con el comentario 111 vente a españa a andalucia q aqui todos te adoramos


sábado, 06 noviembre, 2010 ×

plissss go to the spain

sábado, 06 noviembre, 2010 ×

Justin you are very very very very ... gallant here in españa we will be waiting for you with the opened hands and I fill with enthusiasm ..! I am charmed with your voice you are very very pretty come one day to espeña to sing the income they were becoming exhausted ..;D
Ĵùstín ❤

sábado, 06 noviembre, 2010 ×

anjara justin no quieere salir con tigoo anda fRikíi con migo siii a si k a calllar aunke no te conosca okiis ...¡!
BEngga fea no te agas ilusiiiones okiis..!
Bennga xAoo
JUstin ers el mejor muy wapo y kantaass de maraaaaaaaaaabilllas

sábado, 06 noviembre, 2010 ×

Justin happens of going to bolibia, chili etc you come to españa.
You are very very very very very very handsome sing very well and have a marvellous voice.
I am very a your fan
I love you, I love you

miércoles, 10 noviembre, 2010 ×

hello me llamo johana y quiero decir que esta cancion esta padricima desde el dia en que lo bi . m gust justin bieber y chiquito pero no tanto como justin pero lo unico que yo digo es que justin never say never q never deje su talento pase lo que pase aun q digan que es gay tan soslo por la voz es absurdo que dicen algunos de el yo digo que tienen celos de el por que todas las chicas se mueren porel y el que lo insulta es un par de fenomeno por q no sabe ver chicos guapos al igual que justin bueno que se miren al espejo ante de insultar par de tarados estoy de acuer do con los que aman a justin y sigan asi bueno bye chicas y chicos gracias por su comprencion
amooooooooooooooooooo a justin bieber x li00pre es my heart

sábado, 13 noviembre, 2010 ×

justin biber es el que tiene la voz mas ridicula de todos los que conozco y no es de broma
puuuuuuaaaaaagggggggg justin das asco

martes, 23 noviembre, 2010 ×

Justin bieber: eres el mejor puff...kiero ke sepa ke mi novia tekiere muxo,, Sigue asi ke tendras muxas chicas tekiero friend

martes, 23 noviembre, 2010 ×

ahhh!Se me olvidaba mi tuenti es:jose david amoanatalia

Soy de Andalucia:sevilla

martes, 23 noviembre, 2010 ×

para la canción esta xevere, sobretodo con los papacitos de Jaden Smith y Justin Bieber
me encantan los 2, pero creo que Jaden es pa' mi
Te kiero Jaden :)eres el xico de mi vida
Aver si vienen los 2 para Perú....Bela

miércoles, 24 noviembre, 2010 ×

muy buen tema aunke a justin lo encuentro k canta como mujer pero bn igual pero el otro negrito weu k a a tener futuro jajja

sábado, 27 noviembre, 2010 ×

wOw...!! supEr la canciiOn...!!!
jUstin TAD me encanta como caNtas, a ladO
dEl niniitOh jadEn q es mega genial su estilO
super cool hahaha...!! ^.^...!!
cheiiEm...!! ^.*

sábado, 27 noviembre, 2010 ×

jUstin esta musica me encanta que te va&a mu& bien con tus canciones & cuidate ha eres bonito mua¡¡¡¡¡¡.....`^^^

sábado, 04 diciembre, 2010 ×

Amo esta cancion :D :D :D :D :D :D

miércoles, 08 diciembre, 2010 ×

me a encantado tu letra es fantastica te kiero un monton besos muy fuertes!!

martes, 14 diciembre, 2010 ×

oOLA justin bieber cada ves mas estas mejor ..... cada dia cantas bn esta loko esta cancion al=qe todas .... justin ven a peru recuerda qe aqi tambien tiens fansss qe teqieren muchoOO tienes qe venir a pèru^^
te qeremos justin bieber eres un amor.......^^

viernes, 17 diciembre, 2010 ×


martes, 21 diciembre, 2010 ×

Justin tio te amoo (LL)
me encantas al pricipio no me gustabas me precias un chulito... pero empeze a ver tus videos uno por uno y me encantaste, me enamoraste (L)cantas super bien y eres una gran persona, deseo conocerte soy de valladolid españa y tengo 17 años, me encantan los animales como a ti y en la personalidad me parezco mucho a tii ;)
deseo conocertee! aber si bienes a españa!!!
teek (LL)

martes, 28 diciembre, 2010 ×

hola justin quiero decirte que te amo con todo el corazon vente a españa te lo suplico



lunes, 03 enero, 2011 ×


lunes, 10 enero, 2011 ×

si justin canta muy bien y ademas es guapo me encanta espero poder conocerlo algun dia

lunes, 10 enero, 2011 ×

justin bieber lo mejor q hay en el mundo tus canciones me facinan especialmente el primer disco q salio en el peruuuuuuuuuuuuuu

rosa =la cristalina para ti mas na
lunes, 10 enero, 2011 ×

hola me llamo rosa espero q algun dia vengas al peru a dar un duper mega extraordinario concierto aunq yo no iria p q no puedo ir no soy lo suficiente para pagar un boleto pero yo podria ver en las noticias .¡con muchisimo amor de rosa angelica!chamo espero q vengasssssssssssssssssssss

domingo, 16 enero, 2011 ×

awww de lOO maQziimO la qanzsiooN nu maa iegaa taan geniaaL pff la vrdd algwun dia me cazsaree cn juzstiin maa jojo bnOO aih qq zsoñar nuu? zsalee pzss bzsOOzsz Ooqq mOOaqqzzzs

iLii juzstiin azsii aquerdenzsee de la peli 25 de marzsOOO

viernes, 21 enero, 2011 ×

me llamo valentina y tengo una amiga que se llama lucía las 2 somos las fans números 1

viernes, 21 enero, 2011 ×

Justin Bieber esta re bueno!!

martes, 22 febrero, 2011 ×

PPPPPPffff.... siii va a ir a nose donde pu*** q ya fueee
ni haiii va a argentina de acuerdo con el comentario 125 de unaaa
en argentinaa estamos masss buenas nosotras qqqq mmmmm.... ♥

domingo, 27 febrero, 2011 ×


viernes, 04 marzo, 2011 ×

me encanta never say never y me gustaria ser amigo de ju7stin beiber

viernes, 04 marzo, 2011 ×

el 163 soy yo tu fan numero uno amor y paz

viernes, 04 marzo, 2011 ×

me gustaria justin que si entras a esta pagina al 163 164 y 165 lo aceptes como amigo y mandes un comentario

sábado, 05 marzo, 2011 ×

este niñoo es wapiisiimoo!!! mee encantaaa!!! y ademass canta genial y es un chicoo muy umildee i love justin bieber

lunes, 07 marzo, 2011 ×

justin 3s 3l mej0r l0 am0 y t0das sus cancion3s s0n sup3r c00l y 3sta wapisim0 t3 am0 justin!!!

miércoles, 09 marzo, 2011 ×



miércoles, 09 marzo, 2011 ×


lunes, 14 marzo, 2011 ×

jostin bieber te aaaaaaaaaaammmmmmmmmmoooooooooo y siempre q sales en revistas te imajino a ty alado de mi y de hecho tengo novio pro siento k aty tanbien a ty y sy keres contestar este es mi messenyer angells_sexi07@hotmail.com

miércoles, 16 marzo, 2011 ×

Holaa soii saraa i tengo 14 años soi de espeña (galicia) me encantaa justin bieber eres el mejor me encantan tus canciones & tambien eres mui pero que mui guapo tendrias que venir un dia por galicia a dar un conciertoo que sepas que aqui te queremos un monton eres genial...I LOVE JUSTIN BIEBER !!!!

miércoles, 16 marzo, 2011 ×

te amo justin quisiera vivir comtigo te amooooooooooooooooooooooooooooooooooooooooooooo lo amigo de mi cole dicen que tu eres pajaro y nosotra las hembra la fans numero 1 decimo que nos

viernes, 18 marzo, 2011 ×

justin boujor jet aime je vous souhaita venir en france

Emilia Mautino
sábado, 19 marzo, 2011 ×

A mi me gustaria ser famoso como el tubo tanta suerte! lo admiro! lo envidio! y lo quiero mucho!

domingo, 20 marzo, 2011 ×

olaaa justin biber esta cansion esta muy lindaa tkm y syempr te voy a qrer y quyero q sepas q sos muy lindooo yoop ckandela `perez colman

miércoles, 23 marzo, 2011 ×

justin me muero por conocerte te adoro me encantan todas tus caciones I LOVE JUSTIN BIEBER***...sueño con conocerte y si alguna vez miras a las estrellas alli estare dandote
un millon de besos para ti**** TE QUIERO


lunes, 28 marzo, 2011 ×


lunes, 28 marzo, 2011 ×

es un gran bobo encreido cree que con su cara conquista a todos

lunes, 28 marzo, 2011 ×

ami por lo normal me encanta jaden smith; ¡oye guapo si tu jaden smith! si ves esto te paso mi msn ok es akemy98lopez@live.com.mx pues asi podremos conversar hacerca de nosotros ok guapo nos vemos por favor revisa esta pagina es muy importante te quiero xoxoxoxox tu amiga ................. buscame ok pronto me veras por alla o vienes por mi aqui te espero bye xoxoxoxo..

jueves, 31 marzo, 2011 ×


sábado, 02 abril, 2011 ×

joe como os liais a hablar y unas cuantas cosas:
-dejar ya de echarle flores por q tampoco es para tanto.
-hijos mios,ni voz hermosa ni leches a ver os enterais de q existen los retoqes o q os creeis q canta asi.
-por,cierto menuda voz de niña q tiene.
-y,os gusta el?bbbuuuaaaajjj!!!
pero si es un feto,vaya pelo q tiene parece un casco.
-y la ropa...
con la capuchita esa q se pone esta ridiculo y las gorras lo mismo digo.
no pierdo mas el tiempo con vosotros a si q adios.

el hijo de will smith por lo menos es normal no como el justin de las narices.
ah y la anonima del 28 de marzo q dejo su msn:
no pongas tu msn o lo q sea en internet q luego lo pilla un pederasta y la lias y deja ya de soñar q no va a venir jaden smith y va a coger el msn por qe tu le importas una mierd* te enteras
adios pringaos

domingo, 03 abril, 2011 ×

justin sos el mejor artista del mundo aunque jaden smith no se queda atras... te amooooooooooo justin sos mi vida sos hermoso,cool...sos perfectoooooo te amo ah y jaden smith tambien es hermoso!!! bye bye

lunes, 04 abril, 2011 ×

Me gusta mucho esta cancioon ;)
Y eso que no soy ala una fanatica de justin pero si meg suta ♥

jueves, 07 abril, 2011 ×

esta cacion es chevre mui biena hojala venge aca a guayaquil

lunes, 18 abril, 2011 ×

Hola justin mencantaria k lelleras este mensage pero creo k es imposible amas tu no entiendes español.

Me llamo marina i soy una de tus mayores fans.

cuando vendras a barcelona?¿ :)

I LOVE YOU!!!!!!!

jueves, 21 abril, 2011 ×

Yo diigo !! q es la primera cancion de justin q me facina solo por Jaden :D !!!

viernes, 22 abril, 2011 ×

ya ya ya toooooooooooooodo para justin pero creo k jaden se merece un buen aplauso creedme es grande lo se....

viernes, 22 abril, 2011 ×

me encanta justin drew bieber es el mejor junto con jaden smith usher and justin timberlake ven a sevilla justin

viernes, 22 abril, 2011 ×

wuao amooooo a justin y a jaden I love chicos cantan super jb eres un papacito y jaden eres super lindo los amoooooooooo.... <3 <3 <3

de jb
viernes, 22 abril, 2011 ×

chicas si son stupidas pierden su tiempo en jb. esoo se los digo por que jb es mi novio ok haci que callence los dedos (las bocas)... el es mio y de nadien mas ok..... hay mi amor acuedate que mañana me regreso a california te amo novio.....

viernes, 22 abril, 2011 ×

tu eres la estupida re mamagueva me imagino que nisiquiera conoces a jb..
te amo jb

viernes, 22 abril, 2011 ×

de verdad eres una re mamagueva te odio maldita coño de tu madre me imagiino que tu madre te enseño a ser mentirosa te odio mamagueva re puta....
Ilove justin y jaden

viernes, 22 abril, 2011 ×

@de jb

estupidas crias peliando entre si ! es obio que una obessiva y la otra una mentirosa dudo mucho que sea tu novio si es el novio de selena gomez punto uno punto dos no creo que sepas ingles si no como lo conocerias ? pateticas

sábado, 23 abril, 2011 ×

hola justin me llamo pame y mi mejor amiga yane somos re pero re fanaticas tuyas yo tengo 11 años y yane tiene 10 años te amamooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo con todo mi corazoooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooon

de jb
domingo, 24 abril, 2011 ×

el anonimo que contesto lo que escribi que jb es mi novio eso es verdad y yo si hablo ingles y la otra chica que me ofendio disculpa pero en ningun momento me meti con tigo solo dije la verdad jb te amo mi amor.

domingo, 24 abril, 2011 ×

disculpa de jb pero solamete escribi eso por que me molesto tanto lo que pusiste este ummm vamos hacer amigas si...

martes, 26 abril, 2011 ×

justin es el mejor en toda la faz de la tierra y el genial
I love justin bieber lo amo muchisisisisisisisisisisimoo
el es mi novio ja!

viernes, 06 mayo, 2011 ×

si si si

«El más antiguo   ‹Más antiguo   1 – 200 de 223   Más reciente›   El más reciente»